Review



primescript tm fast rt reagent kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    TaKaRa primescript tm fast rt reagent kit
    Primescript Tm Fast Rt Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 87884 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+tm+fast+rt+reagent+kit/PrimeScript+RT+Reagent+Kit/pmc13010969-83-33-43
    Average 99 stars, based on 87884 article reviews
    primescript tm fast rt reagent kit - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    cDNA Synthesis:

    Article Title: Identification and validation of potential shared diagnostic markers for sepsis-induced ARDS and cardiomyopathy via WGCNA and machine learning
    Article Snippet: .. Total RNA was extracted using TRIzol reagent (Takara, Japan), followed by cDNA synthesis with the PrimeScript TM FAST RT reagent Kit (Takara, Japan). mRNA quantification was performed by qRT-PCR using the TB Green® Premix Ex Taq TM II FAST qPCR kit (Takara, Japan) on a 7,300 Real-Time PCR System (Applied Biosystems, United States). ..

    Article Title: Multi-omics analysis reveals RBPJ-mediated regulation of EGF/ACTN2 / MYPN / COL21A1 in fibroblast during oviduct functional remodeling of duck
    Article Snippet: .. Total RNA was extracted from fibroblasts (OE and C) and oviduct tissue (laying and ceasing laying) using TRIzol® Reagent (15596026, Invitrogen, USA) according to the manufacturer’s instructions. cDNA synthesis was performed using the PrimeScript TM FAST RT reagent Kit with gDNA Eraser (RR092A, Takara, China). .. Gene-specific primers for qPCR were designed using the Primer-BLAST tool (National Center for Biotechnology Information, NCBI), with Beta-actin ( ACTB ) as the internal reference gene to normalize target gene expression.

    Quantitative RT-PCR:

    Article Title: Identification and validation of potential shared diagnostic markers for sepsis-induced ARDS and cardiomyopathy via WGCNA and machine learning
    Article Snippet: .. Total RNA was extracted using TRIzol reagent (Takara, Japan), followed by cDNA synthesis with the PrimeScript TM FAST RT reagent Kit (Takara, Japan). mRNA quantification was performed by qRT-PCR using the TB Green® Premix Ex Taq TM II FAST qPCR kit (Takara, Japan) on a 7,300 Real-Time PCR System (Applied Biosystems, United States). ..

    Article Title: The role of cell surface RNAs in hepatocellular carcinoma.
    Article Snippet: Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide.. The composition of the tumor cell surface critically regulates cellular interactions with the microenvironment, influencing tumor initiation and progression.. While the existence of cell surface RNA has been recently explored in other contexts, its presence on liver cancer cells and its specific impact on HCC progression are unknown.

    Real-time Polymerase Chain Reaction:

    Article Title: Identification and validation of potential shared diagnostic markers for sepsis-induced ARDS and cardiomyopathy via WGCNA and machine learning
    Article Snippet: .. Total RNA was extracted using TRIzol reagent (Takara, Japan), followed by cDNA synthesis with the PrimeScript TM FAST RT reagent Kit (Takara, Japan). mRNA quantification was performed by qRT-PCR using the TB Green® Premix Ex Taq TM II FAST qPCR kit (Takara, Japan) on a 7,300 Real-Time PCR System (Applied Biosystems, United States). ..

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    Article Title: ABA signaling is involved in the regulation of BSK1 stability mediated by the UBP24-PUB25/26 module in Arabidopsis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GFP TransGen Biotech Cat#HT801-01; RRID: AB_2922385 anti-His TransGen Biotech Cat#HT501-01; RRID: AB_2801417 anti-GST TransGen Biotech Cat#HT601-01; RRID: AB_2922384 anti-MYC TransGen Biotech Cat#HT101-01; RRID: AB_2832251 anti-HA TransGen Biotech Cat#HT301-01; RRID: AB_3076171 anti-MBP TransGen Biotech Cat#HT701-01; RRID: AB_3714551 anti-LUC Sigma-Aldrich Cat#L0159; RRID: AB_260379 anti-Actin ABclonal Cat#AC009; RRID: AB_2771701 anti-Thr abcam Cat#ab92570; RRID: AB_10562142 anti-Ub ABclonal Cat#A0162; RRID: AB_2756992 Bacterial and virus strains E.coli DH5α Weidibio Cat#DL1001M E.coli BL21-CodonPlus (DE3) Weidibio Cat#EC1007M .. GV3101(pSoup-p19) Weidibio Cat#AC1003L Agrobacterium tumefaciens EHA105 Weidibio Cat#AC1010M Chemicals, peptides, and recombinant proteins TRIzol reagent Takara Cat#9109 PrimeScript TM FAST RT Reagent Kit with gDNA Eraser Takara Cat#RR092A TransStart® Top Green qPCR SuperMix TransGen Biotech Cat#AQ131 2, 4-Epibrassinolide (EBR) Coolaber Cat#CE5051 Abscisic acid (ABA) Sangon Biotech Cat#A600001 Murashige and Skoog (MS) medium PhytoTech Cat#HWY0519268A Morpholineethanesulfonic acid (MES) Sangon Biotech Cat#A100169 KCl Sangon Biotech Cat#A631028 CaCl 2 Sangon Biotech Cat#A501330 KOH Sinopharm Chemical Reagent Cat#10017018 Tris Sangon Biotech Cat#A600194 Sucrose Sangon Biotech Cat#A502792 MgCl 2 Sigma-Aldrich Cat#M8266 DTT Sangon Biotech Cat#A300862 Phenylmethanesulfonyl fluoride (PMSF) Sangon Biotech Cat#A100754 EDTA BIORIGIN Cat#BN20003 MG132 Selleck Cat#S2619 Cycloheximide (CHX) AbMole Cat#M4879 MnCl 2 ⋅4H 2 O Greagent Cat#G21136B ATP Yuanye Bio-Technology Cat#S18055 ATP-gamma-S (ATPγS) abcam Cat#ab138911 p-nitrobenzyl mesylate (PNBM) abcam Cat#ab138910 NaCl Sangon Biotech Cat#A100241 Critical commercial assays High sensitive ECL luminescence reagent Sangon Biotech Cat#C500044 (Continued on next page) Cell Reports 45, 117187, April 28, 2026 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-GFP magnetic agarose beads Smart-Lifesciences Cat#SM038001 GST Sepharose 4FF Resin Sangon Biotech Cat#C600031 Deposited data IP-MS proteomics This paper PXD074339 Phosphorylation MS proteomics This paper PXD074303 Experimental models: Organisms/strains Arabidopsis: Col-0 (WT) Widely distributed N/A Arabidopsis: bsk1-1 Shi et al. 56 N/A Arabidopsis: pub25/26 Wang et al. 27 N/A Arabidopsis: ubp24 Zhao et al. 26 N/A Arabidopsis: gBSK1/bsk1-1 This paper N/A Arabidopsis: 35S:BSK1-GFP This paper N/A Arabidopsis: 35S:BSK1-GFP/ubp24 This paper N/A Arabidopsis: 35S:BSK1-GFP/pub25/26 This paper N/A Arabidopsis: 35S:PUB25-GFP This paper N/A Arabidopsis: 35S:PUB26-GFP This paper N/A Arabidopsis: 35S:PUB25-GFP/ubp24 This paper N/A Arabidopsis: 35S:PUB26-GFP/ubp24 This paper N/A Arabidopsis: 35S:UBP24-GFP This paper N/A Arabidopsis: gUBP24/ubp24 Zhao et al. 26 N/A Arabidopsis: pub25/26/bsk1-1 This paper N/A Arabidopsis: bsk1-1/ubp24 This paper N/A Arabidopsis: gPUB25/pub25/26 This paper N/A Arabidopsis: gPUB26/pub25/26 This paper N/A Arabidopsis: gPUB25 T116A /pub25/26 This paper N/A Arabidopsis: gPUB25 T116D /pub25/26 This paper N/A Nicotiana benthamiana This paper N/A Oligonucleotides See list of primers in Table S1 This paper N/A Recombinant DNA BSK1-GFP This paper N/A BSK1-MYC This paper N/A His-BSK1 This paper N/A GST-BSK1 This paper N/A MBP-BSK1 This paper N/A BSK1-YCE This paper N/A cLUC-BSK1 This paper N/A gBSK1-GFP This paper N/A gPUB25-GFP This paper N/A gPUB26-GFP This paper N/A PUB25-GFP This paper N/A PUB26-GFP This paper N/A PUB25-MYC This paper N/A PUB26- MYC This paper N/A His-PUB25 This paper N/A His-PUB26 This paper N/A GST-PUB25 This paper N/A GST-PUB26 This paper N/A MBP-PUB25 This paper N/A (Continued on next page) 16 Cell Reports 45, 117187, April 28, 2026

    Article Title: The role of cell surface RNAs in hepatocellular carcinoma.
    Article Snippet: Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide.. The composition of the tumor cell surface critically regulates cellular interactions with the microenvironment, influencing tumor initiation and progression.. While the existence of cell surface RNA has been recently explored in other contexts, its presence on liver cancer cells and its specific impact on HCC progression are unknown.

    Reverse Transcription:

    Article Title: Development of a progressive HIV-1-Like infection model in northern pig-tailed macaques using stHIV-1sv/G53D
    Article Snippet: .. Total RNA extracted from PBMCs was reverse transcribed using a PrimeScript TM Fast RT Reagent Kit with gDNA Eraser (RR092A, TAKARA, Japan). .. The cDNA of 28 genes was amplified using TB Green® Premix Ex Taq TM II (RR820A, TAKARA, Japan), with normalization to RPL13A expression determined in parallel reactions.

    Article Title: The role of cell surface RNAs in hepatocellular carcinoma.
    Article Snippet: Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide.. The composition of the tumor cell surface critically regulates cellular interactions with the microenvironment, influencing tumor initiation and progression.. While the existence of cell surface RNA has been recently explored in other contexts, its presence on liver cancer cells and its specific impact on HCC progression are unknown.

    Concentration Assay:

    Article Title: Circadian Phase Determines Tissue-Specific Adaptations to Long-Term Exercise in Obese Mice
    Article Snippet: .. Total RNA was extracted using the NucleoSpin RNA Kit (Takara Bio Inc., Kusatsu, Japan) according to the manufacturer’s instructions, and RNA concentration and purity were determined using a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA was synthesized using the PrimeScript TM FAST RT Reagent Kit with gDNA Erase (Takara Bio Inc., Kusatsu, Japan). .. Quantitative PCR amplification was performed on a Thermal Cycler Dice ® Real Time System IV (Takara Bio Inc., Kusatsu, Japan) using TB Green ® Premix Ex TaqTM II FAST qPCR (Takara Bio Inc., Kusatsu, Japan), following the recommended protocol.

    Spectrophotometry:

    Article Title: Circadian Phase Determines Tissue-Specific Adaptations to Long-Term Exercise in Obese Mice
    Article Snippet: .. Total RNA was extracted using the NucleoSpin RNA Kit (Takara Bio Inc., Kusatsu, Japan) according to the manufacturer’s instructions, and RNA concentration and purity were determined using a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA was synthesized using the PrimeScript TM FAST RT Reagent Kit with gDNA Erase (Takara Bio Inc., Kusatsu, Japan). .. Quantitative PCR amplification was performed on a Thermal Cycler Dice ® Real Time System IV (Takara Bio Inc., Kusatsu, Japan) using TB Green ® Premix Ex TaqTM II FAST qPCR (Takara Bio Inc., Kusatsu, Japan), following the recommended protocol.

    Synthesized:

    Article Title: Circadian Phase Determines Tissue-Specific Adaptations to Long-Term Exercise in Obese Mice
    Article Snippet: .. Total RNA was extracted using the NucleoSpin RNA Kit (Takara Bio Inc., Kusatsu, Japan) according to the manufacturer’s instructions, and RNA concentration and purity were determined using a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA was synthesized using the PrimeScript TM FAST RT Reagent Kit with gDNA Erase (Takara Bio Inc., Kusatsu, Japan). .. Quantitative PCR amplification was performed on a Thermal Cycler Dice ® Real Time System IV (Takara Bio Inc., Kusatsu, Japan) using TB Green ® Premix Ex TaqTM II FAST qPCR (Takara Bio Inc., Kusatsu, Japan), following the recommended protocol.

    Article Title: The role of cell surface RNAs in hepatocellular carcinoma.
    Article Snippet: Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide.. The composition of the tumor cell surface critically regulates cellular interactions with the microenvironment, influencing tumor initiation and progression.. While the existence of cell surface RNA has been recently explored in other contexts, its presence on liver cancer cells and its specific impact on HCC progression are unknown.

    Staining:

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    Enzyme-linked Immunosorbent Assay:

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    Polyacrylamide Gel Electrophoresis:

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    Multiplex Assay:

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    Immunohistochemistry:

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    RNA Sequencing:

    Article Title: Targeting CTGF overcomes resistance to CSF1R inhibitors by preventing CAF activation in colorectal cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER BLZ945 MCE Cat#HY-12768 Pamrevlumab (anti-CTGF) Selleck Cat#A2042 EDHB sigma Cat# E24859 LY294002 MCE Cat#HY-10108 740-Y-P MCE Cat#HY-P0175 Anti-PD-1 monoclonal antibody selleck Cat#A2122 Matrigel VivoMatter Biotech Cat#VM002-PRF-10 Organoid Complete Medium VivoMatter Biotech Cat#RSQ-OCM1102 Fetal Bovine Serum Umedium Cat#3021A Critical commercial assays Masson’s Trichrome Stain Kit Solarbio Cat#G1340 Sirius Red Stain Kit Solarbio Cat#G1472 Mouse CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml037697 Human CTGF ELISA KIT Shanghai Enzyme-linked Biotechnology Cat#ml025961 Omni-Easy TM One-step Color PAGE Gel Rapid Preparation Kit EpiZyme Cat#PG212 Multiplex Fluorescent Immunohistochemistry Staining Kit absin Cat#abs50029 PrimeScript TM FAST RT reagent Kit with gDNA Eraser Takara Cat#RR092A Talent qPCR PreMix TIANGEN Cat#FP209 Deposited data Bulk RNA-seq raw data This paper GSA:PRJCA040243 IMC raw data This paper GSA:OMIX012148 Experimental models: Cell lines CT26 Pricella Biotechnology Cat#CL-0071 CMT93 Pricella Biotechnology Cat#CL-0920 NIH/3T3 Pricella Biotechnology Cat#CL-0171 HCT-8 Pricella Biotechnology Cat#CL-0098 Caco2 Pricella Biotechnology Cat#CL-0050 HCT15 Pricella Biotechnology Cat#CL-0097 HT29 Pricella Biotechnology Cat#CL-0118 HCT116 Pricella Biotechnology Cat# CL-0096 HEK293T ATCC Cat#CRL-3216 LS174T Pricella Biotechnology Cat# CL-0145 m-CAF This paper N/A CT26-LUC This paper N/A CMT93-LUC This paper N/A Experimental models: Organisms/strains C57BL/6 mice Changsheng Biotechnology N/A BALB/c mice Changsheng Biotechnology N/A NOD/ShiLtJGpt-Prkdc em26Cd52 II2rg em26Cd22 /Gpt GemPharmatech Cat#T001475 C57BL/6JGpt-Apc em1Cflox /Gpt GemPharmatech Cat#T059534 C57BL/6JCya-VillinCre ERT2 cyagen Cat#C001433 LSL-K-ras G12D cyagen Cat#C001064 Oligonucleotides Ctgf-sgRNA1: CGCACGTCCATGCTGCACAG SYNBIO TECHNOLOGIES N/A Ctgf-sgRNA2: TTTGGAAGGACTCACCGCTG SYNBIO TECHNOLOGIES N/A (Continued on next page) e2 Cell Reports Medicine 6, 102480, December 16, 2025 ..

    Recombinant:

    Article Title: ABA signaling is involved in the regulation of BSK1 stability mediated by the UBP24-PUB25/26 module in Arabidopsis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GFP TransGen Biotech Cat#HT801-01; RRID: AB_2922385 anti-His TransGen Biotech Cat#HT501-01; RRID: AB_2801417 anti-GST TransGen Biotech Cat#HT601-01; RRID: AB_2922384 anti-MYC TransGen Biotech Cat#HT101-01; RRID: AB_2832251 anti-HA TransGen Biotech Cat#HT301-01; RRID: AB_3076171 anti-MBP TransGen Biotech Cat#HT701-01; RRID: AB_3714551 anti-LUC Sigma-Aldrich Cat#L0159; RRID: AB_260379 anti-Actin ABclonal Cat#AC009; RRID: AB_2771701 anti-Thr abcam Cat#ab92570; RRID: AB_10562142 anti-Ub ABclonal Cat#A0162; RRID: AB_2756992 Bacterial and virus strains E.coli DH5α Weidibio Cat#DL1001M E.coli BL21-CodonPlus (DE3) Weidibio Cat#EC1007M .. GV3101(pSoup-p19) Weidibio Cat#AC1003L Agrobacterium tumefaciens EHA105 Weidibio Cat#AC1010M Chemicals, peptides, and recombinant proteins TRIzol reagent Takara Cat#9109 PrimeScript TM FAST RT Reagent Kit with gDNA Eraser Takara Cat#RR092A TransStart® Top Green qPCR SuperMix TransGen Biotech Cat#AQ131 2, 4-Epibrassinolide (EBR) Coolaber Cat#CE5051 Abscisic acid (ABA) Sangon Biotech Cat#A600001 Murashige and Skoog (MS) medium PhytoTech Cat#HWY0519268A Morpholineethanesulfonic acid (MES) Sangon Biotech Cat#A100169 KCl Sangon Biotech Cat#A631028 CaCl 2 Sangon Biotech Cat#A501330 KOH Sinopharm Chemical Reagent Cat#10017018 Tris Sangon Biotech Cat#A600194 Sucrose Sangon Biotech Cat#A502792 MgCl 2 Sigma-Aldrich Cat#M8266 DTT Sangon Biotech Cat#A300862 Phenylmethanesulfonyl fluoride (PMSF) Sangon Biotech Cat#A100754 EDTA BIORIGIN Cat#BN20003 MG132 Selleck Cat#S2619 Cycloheximide (CHX) AbMole Cat#M4879 MnCl 2 ⋅4H 2 O Greagent Cat#G21136B ATP Yuanye Bio-Technology Cat#S18055 ATP-gamma-S (ATPγS) abcam Cat#ab138911 p-nitrobenzyl mesylate (PNBM) abcam Cat#ab138910 NaCl Sangon Biotech Cat#A100241 Critical commercial assays High sensitive ECL luminescence reagent Sangon Biotech Cat#C500044 (Continued on next page) Cell Reports 45, 117187, April 28, 2026 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER anti-GFP magnetic agarose beads Smart-Lifesciences Cat#SM038001 GST Sepharose 4FF Resin Sangon Biotech Cat#C600031 Deposited data IP-MS proteomics This paper PXD074339 Phosphorylation MS proteomics This paper PXD074303 Experimental models: Organisms/strains Arabidopsis: Col-0 (WT) Widely distributed N/A Arabidopsis: bsk1-1 Shi et al. 56 N/A Arabidopsis: pub25/26 Wang et al. 27 N/A Arabidopsis: ubp24 Zhao et al. 26 N/A Arabidopsis: gBSK1/bsk1-1 This paper N/A Arabidopsis: 35S:BSK1-GFP This paper N/A Arabidopsis: 35S:BSK1-GFP/ubp24 This paper N/A Arabidopsis: 35S:BSK1-GFP/pub25/26 This paper N/A Arabidopsis: 35S:PUB25-GFP This paper N/A Arabidopsis: 35S:PUB26-GFP This paper N/A Arabidopsis: 35S:PUB25-GFP/ubp24 This paper N/A Arabidopsis: 35S:PUB26-GFP/ubp24 This paper N/A Arabidopsis: 35S:UBP24-GFP This paper N/A Arabidopsis: gUBP24/ubp24 Zhao et al. 26 N/A Arabidopsis: pub25/26/bsk1-1 This paper N/A Arabidopsis: bsk1-1/ubp24 This paper N/A Arabidopsis: gPUB25/pub25/26 This paper N/A Arabidopsis: gPUB26/pub25/26 This paper N/A Arabidopsis: gPUB25 T116A /pub25/26 This paper N/A Arabidopsis: gPUB25 T116D /pub25/26 This paper N/A Nicotiana benthamiana This paper N/A Oligonucleotides See list of primers in Table S1 This paper N/A Recombinant DNA BSK1-GFP This paper N/A BSK1-MYC This paper N/A His-BSK1 This paper N/A GST-BSK1 This paper N/A MBP-BSK1 This paper N/A BSK1-YCE This paper N/A cLUC-BSK1 This paper N/A gBSK1-GFP This paper N/A gPUB25-GFP This paper N/A gPUB26-GFP This paper N/A PUB25-GFP This paper N/A PUB26-GFP This paper N/A PUB25-MYC This paper N/A PUB26- MYC This paper N/A His-PUB25 This paper N/A His-PUB26 This paper N/A GST-PUB25 This paper N/A GST-PUB26 This paper N/A MBP-PUB25 This paper N/A (Continued on next page) 16 Cell Reports 45, 117187, April 28, 2026



    Similar Products

    99
    TaKaRa primescript tm fast rt reagent kit
    Primescript Tm Fast Rt Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+tm+fast+rt+reagent+kit/PrimeScript+RT+Reagent+Kit/pmc13010969-83-33-43
    Average 99 stars, based on 1 article reviews
    primescript tm fast rt reagent kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa primescript fast rt reagent kit with gdna eraser
    Primescript Fast Rt Reagent Kit With Gdna Eraser, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+tm+fast+rt+reagent+kit/PrimeScript+FAST+RT+reagent+Kit+with+gDNA+Eraser/custom%40rr092a%4042135820
    Average 99 stars, based on 1 article reviews
    primescript fast rt reagent kit with gdna eraser - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa primescript tm fast rt reagent kit takara cat
    Primescript Tm Fast Rt Reagent Kit Takara Cat, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+tm+fast+rt+reagent+kit/PrimeScript+FAST+RT+reagent+Kit+with+gDNA+Eraser/pm41575851-614-52-58
    Average 99 stars, based on 1 article reviews
    primescript tm fast rt reagent kit takara cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results